The purpose of this research was to study the association between polymorphisms of the ODF1 gene and idiopathic asthenozoospermia in Sichuan. We analyzed the distribution of the ODF1 gene polymorphism in 106 idiopathic asthenozoospermia and 104 fertile men with normospermic parameters. The result shows that the 27-bp deletion (c.656delACCCCTGCAGCCCCTGCAACCCGTGCA) was increased significantly in idiopathic asthenozoospermic patients compared with fertile counterparts (OR=1.783，95%CI=1.178~2.700，P=0.006) and ten amino acids (C218-P229delins NPCSPCNPCS) deletion were discovered by MEGA. Moreover, PROVEAN and PMP analysis predicted that this deletion mutation potentially damage to the function of protein. Therefore, these results suggested that the 27-bp deletion variant in ODF1 was highly likely to be one of the genetic factors for idiopathic asthenozoospermia among males in Sichuan.
