Objective Gene vaccine security is of concern because of the possibility of insertion mutagenesis resulting in inactivation of tumor suppressor or activation of oncogene. The purpose of this study was to examine the potential of anticaries DNA vaccine pcDNA3gtfB integrating into the host cell genome.Methods Anticaries DNA vaccine pcDNA3gtfB was constructed by the previous study. The gtfB gene（904～4 578 bp, genebank M17361） was cloned from Streptococcus mutans GS5. 36 Wistar rats were divided into 2 groups: submandibular glandtargeted injection（SGT） group and control group. Rats in SGT group were injected with 100 μg of plasmid pcDNA3gtfB, rats in control group with PBS solution. Genomes from submandibular gland, kidney, heart, liver, lung, and brain tissues were isolated later in 12 weeks. Genomes from different tissues were purified by lowmelting agarose electrophoresis. Using the purified genomes as template, plasmid integration were examined by PCR（upper primer: 5′ATATGGTACCATGACCGAAGCGACATCTAAGCAAGA3′, lower primer: 5′ACTACTCGAGTTAGAACCATTGACCCTG AGCATTGC3′）. The sensitivity level of PCR was determined by adding gradient plasmid copies into genomes in control group.Results The examination of 6 tissues failed in revealing any evidence of integration at the sensitivity level that could detect 1 copy integration in 10 000 nuclei.Conclusion The potential frequency of plasmid pcDNA3gtfB integration into host cell genome would not exceed that of the spontaneous mutation. It was indicated that pcDNA3gtfB was genetically safe as a promising anticarious DNA vaccine.
